MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/smrnaseq analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-01-07, 15:55 UTC based on data in:

/fusion/s3/nf-core-awsmegatests/work/smrnaseq/work-cb0af579b24cb8d5a3accd87b2f14ea93fe04832/5d/fcf91d0074a4cd59d4fe18576df4d6

General Statistics

Showing ¹⁴⁰/₁₄₀ rows and ²²/₃₂ columns.

Sample Name	% Duplication	% > Q30	Mb Q30 bases	Reads After Filtering	GC content	% PF	% Adapter	Mean R1 Length	M Ref miRNA reads	IsomiR %	M IsomiR reads	M Reads	Error rate	Non-primary	Reads mapped	% Mapped	% Proper pairs	% MapQ 0 reads	Total seqs	Mean insert	Dups	GC	Avg len	Median len	Failed	Seqs	Dups	GC	Avg len	Median len	Failed	Seqs
c1	91.5%	96.0%	327.1Mb	11.0M	50.5%	81.3%	0.0%	36.0bp	1.2M	0.0%	0.0M	1.2M															95.7%	50.0%	31bp	36bp	36%	11.0M
c1.raw																					90.8%	51.0%	36bp	36bp	45%	13.5M
c1_mature													0.51%	0.0M	2.3M	20.5%	0.0%	0.0%	11.1M	0.0bp
c1_mature_hairpin													3.48%	0.0M	0.5M	6.0%	0.0%	0.0%	8.9M	0.0bp
c1_mature_hairpin_genome													9.01%	0.0M	95.0M	99.1%	0.0%	0.0%	95.9M	0.0bp
c2	90.3%	95.4%	279.4Mb	10.6M	50.2%	81.5%	0.0%	36.0bp	2.0M	0.0%	0.0M	2.0M															95.2%	50.0%	28bp	23bp	27%	10.6M
c2.raw																					89.6%	51.0%	36bp	36bp	36%	13.0M
c2_mature													0.75%	0.0M	4.0M	37.3%	0.0%	0.0%	10.8M	0.0bp
c2_mature_hairpin													3.14%	0.0M	1.2M	17.5%	0.0%	0.0%	7.0M	0.0bp
c2_mature_hairpin_genome													8.38%	0.0M	48.3M	99.0%	0.0%	0.0%	48.8M	0.0bp
c3	83.5%	95.3%	253.3Mb	9.5M	52.4%	77.8%	0.0%	36.0bp	1.5M	0.0%	0.0M	1.5M															87.2%	52.0%	28bp	26bp	27%	9.5M
c3.raw																					83.1%	53.0%	36bp	36bp	36%	12.2M
c3_mature													0.58%	0.0M	2.7M	28.3%	0.0%	0.0%	9.6M	0.0bp
c3_mature_hairpin													3.12%	0.0M	0.9M	12.4%	0.0%	0.0%	7.1M	0.0bp
c3_mature_hairpin_genome													6.09%	0.0M	36.7M	98.1%	0.0%	0.0%	37.4M	0.0bp
c4	90.0%	95.5%	283.3Mb	10.7M	50.8%	73.2%	0.0%	36.0bp	2.2M	0.0%	0.0M	2.2M															96.0%	50.0%	28bp	23bp	27%	10.7M
c4.raw																					89.2%	52.0%	36bp	36bp	45%	14.6M
c4_mature													0.72%	0.0M	4.2M	39.1%	0.0%	0.0%	10.8M	0.0bp
c4_mature_hairpin													3.00%	0.0M	1.0M	14.9%	0.0%	0.0%	6.9M	0.0bp
c4_mature_hairpin_genome													7.58%	0.0M	45.0M	98.9%	0.0%	0.0%	45.5M	0.0bp
c5	88.2%	94.8%	286.2Mb	11.2M	50.9%	72.4%	0.0%	36.0bp	2.2M	0.0%	0.0M	2.2M															94.0%	50.0%	27bp	23bp	27%	11.2M
c5.raw																					86.9%	52.0%	36bp	36bp	45%	15.4M
c5_mature													0.77%	0.0M	4.6M	40.4%	0.0%	0.0%	11.3M	0.0bp
c5_mature_hairpin													3.27%	0.0M	1.1M	15.6%	0.0%	0.0%	7.0M	0.0bp
c5_mature_hairpin_genome													6.75%	0.0M	39.2M	98.6%	0.0%	0.0%	39.7M	0.0bp
c6	91.4%	94.7%	361.8Mb	13.5M	51.3%	82.0%	0.0%	36.0bp	2.2M	0.0%	0.0M	2.2M															96.6%	51.0%	28bp	26bp	27%	13.5M
c6.raw																					90.3%	52.0%	36bp	36bp	55%	16.4M
c6_mature													0.74%	0.0M	5.0M	37.0%	0.0%	0.0%	13.6M	0.0bp
c6_mature_hairpin													3.44%	0.0M	1.2M	13.2%	0.0%	0.0%	8.9M	0.0bp
c6_mature_hairpin_genome													7.86%	0.0M	61.1M	98.7%	0.0%	0.0%	61.9M	0.0bp
c7	88.9%	92.8%	384.1Mb	14.0M	51.1%	79.3%	0.0%	36.0bp	2.0M	0.0%	0.0M	2.0M															96.3%	51.0%	30bp	36bp	36%	14.0M
c7.raw																					87.5%	52.0%	36bp	36bp	55%	17.7M
c7_mature													0.87%	0.0M	4.3M	30.1%	0.0%	0.0%	14.2M	0.0bp
c7_mature_hairpin													3.35%	0.0M	1.1M	10.6%	0.0%	0.0%	10.2M	0.0bp
c7_mature_hairpin_genome													8.79%	0.0M	79.6M	98.9%	0.0%	0.0%	80.5M	0.0bp
cc1	91.5%	94.6%	250.0Mb	10.4M	48.4%	79.5%	0.0%	36.0bp	3.0M	0.0%	0.0M	3.0M															95.2%	48.0%	25bp	22bp	36%	10.4M
cc1.raw																					91.0%	50.0%	36bp	36bp	45%	13.1M
cc1_mature													0.64%	0.0M	5.4M	50.8%	0.0%	0.0%	10.6M	0.0bp
cc1_mature_hairpin													2.85%	0.0M	1.8M	31.7%	0.0%	0.0%	5.6M	0.0bp
cc1_mature_hairpin_genome													4.98%	0.0M	17.6M	98.0%	0.0%	0.0%	18.0M	0.0bp
cc2	90.7%	94.9%	314.4Mb	12.0M	50.4%	84.3%	0.0%	36.0bp	2.3M	0.0%	0.0M	2.3M															95.5%	50.0%	28bp	23bp	45%	12.0M
cc2.raw																					90.2%	51.0%	36bp	36bp	55%	14.3M
cc2_mature													0.71%	0.0M	5.6M	45.4%	0.0%	0.0%	12.3M	0.0bp
cc2_mature_hairpin													3.31%	0.0M	1.0M	14.4%	0.0%	0.0%	7.0M	0.0bp
cc2_mature_hairpin_genome													7.74%	0.0M	52.1M	99.0%	0.0%	0.0%	52.6M	0.0bp
cc3	91.9%	95.0%	274.6Mb	10.2M	50.4%	82.5%	0.0%	36.0bp	2.0M	0.0%	0.0M	2.0M															96.6%	50.0%	28bp	26bp	27%	10.2M
cc3.raw																					91.1%	51.0%	36bp	36bp	36%	12.3M
cc3_mature													0.61%	0.0M	3.6M	34.8%	0.0%	0.0%	10.3M	0.0bp
cc3_mature_hairpin													2.88%	0.0M	1.2M	16.7%	0.0%	0.0%	7.0M	0.0bp
cc3_mature_hairpin_genome													7.99%	0.0M	44.2M	98.7%	0.0%	0.0%	44.8M	0.0bp
cc4	90.7%	94.7%	271.0Mb	11.0M	50.2%	73.4%	0.0%	36.0bp	2.7M	0.0%	0.0M	2.7M															96.2%	50.0%	26bp	23bp	27%	11.0M
cc4.raw																					89.7%	51.0%	36bp	36bp	36%	15.1M
cc4_mature													0.75%	0.0M	5.5M	48.7%	0.0%	0.0%	11.2M	0.0bp
cc4_mature_hairpin													3.18%	0.0M	1.5M	24.0%	0.0%	0.0%	6.1M	0.0bp
cc4_mature_hairpin_genome													6.29%	0.0M	26.8M	98.4%	0.0%	0.0%	27.2M	0.0bp
cc5	90.2%	94.6%	251.2Mb	10.2M	49.4%	78.2%	0.0%	36.0bp	2.5M	0.0%	0.0M	2.5M															96.1%	49.0%	26bp	22bp	45%	10.2M
cc5.raw																					89.1%	51.0%	36bp	36bp	55%	13.1M
cc5_mature													0.77%	0.0M	5.5M	53.0%	0.0%	0.0%	10.4M	0.0bp
cc5_mature_hairpin													3.44%	0.0M	1.2M	22.4%	0.0%	0.0%	5.2M	0.0bp
cc5_mature_hairpin_genome													7.65%	0.0M	30.9M	98.8%	0.0%	0.0%	31.3M	0.0bp
cc6	90.8%	94.6%	359.0Mb	12.6M	51.9%	79.7%	0.0%	36.0bp	1.6M	0.0%	0.0M	1.6M															96.8%	51.0%	30bp	36bp	45%	12.6M
cc6.raw																					89.7%	52.0%	36bp	36bp	55%	15.8M
cc6_mature													0.77%	0.0M	3.3M	26.3%	0.0%	0.0%	12.8M	0.0bp
cc6_mature_hairpin													3.12%	0.0M	0.8M	8.7%	0.0%	0.0%	9.6M	0.0bp
cc6_mature_hairpin_genome													8.02%	0.0M	68.6M	98.7%	0.0%	0.0%	69.5M	0.0bp
cc7	88.1%	92.6%	371.3Mb	14.5M	51.4%	73.5%	0.0%	36.0bp	2.5M	0.0%	0.0M	2.5M															96.1%	51.0%	28bp	23bp	36%	14.5M
cc7.raw																					86.5%	52.0%	36bp	36bp	55%	19.7M
cc7_mature													0.92%	0.0M	5.6M	38.4%	0.0%	0.0%	14.7M	0.0bp
cc7_mature_hairpin													3.17%	0.0M	1.4M	14.8%	0.0%	0.0%	9.4M	0.0bp
cc7_mature_hairpin_genome													6.78%	0.0M	52.5M	98.5%	0.0%	0.0%	53.3M	0.0bp
cpc1	92.5%	96.0%	382.7Mb	15.5M	47.3%	93.7%	0.0%	76.0bp	4.5M	0.0%	0.0M	4.5M															95.8%	47.0%	26bp	22bp	36%	15.5M
cpc1.raw																					95.0%	50.0%	76bp	76bp	55%	16.6M
cpc1_mature													0.75%	0.0M	8.1M	51.4%	0.0%	0.0%	15.8M	0.0bp
cpc1_mature_hairpin													3.09%	0.0M	2.7M	32.8%	0.0%	0.0%	8.3M	0.0bp
cpc1_mature_hairpin_genome													3.07%	0.0M	27.4M	98.2%	0.0%	0.0%	27.9M	0.0bp
cpc2	92.4%	96.2%	384.2Mb	14.6M	49.2%	96.6%	6.1%	76.0bp	2.8M	0.0%	0.0M	2.8M															95.5%	49.0%	27bp	24bp	45%	14.6M
cpc2.raw																					94.2%	51.0%	76bp	76bp	55%	15.1M
cpc2_mature													0.68%	0.0M	6.3M	42.2%	0.0%	0.0%	14.8M	0.0bp
cpc2_mature_hairpin													4.09%	0.0M	1.3M	15.0%	0.0%	0.0%	9.0M	0.0bp
cpc2_mature_hairpin_genome													2.36%	0.0M	65.8M	99.0%	0.0%	0.0%	66.4M	0.0bp
cpc3	94.5%	96.8%	384.6Mb	14.8M	48.9%	94.6%	0.0%	76.0bp	3.6M	0.0%	0.0M	3.6M															97.4%	48.0%	27bp	22bp	45%	14.8M
cpc3.raw																					96.2%	51.0%	76bp	76bp	55%	15.7M
cpc3_mature													0.45%	0.0M	6.0M	40.3%	0.0%	0.0%	15.0M	0.0bp
cpc3_mature_hairpin													2.95%	0.0M	2.0M	21.4%	0.0%	0.0%	9.4M	0.0bp
cpc3_mature_hairpin_genome													2.19%	0.0M	61.0M	98.8%	0.0%	0.0%	61.8M	0.0bp
cpc4	93.7%	96.6%	376.7Mb	15.0M	48.7%	94.0%	4.3%	76.0bp	4.4M	0.0%	0.0M	4.4M															97.2%	48.0%	26bp	22bp	45%	15.0M
cpc4.raw																					95.6%	51.0%	76bp	76bp	55%	16.0M
cpc4_mature													0.42%	0.0M	7.6M	49.7%	0.0%	0.0%	15.3M	0.0bp
cpc4_mature_hairpin													3.30%	0.0M	2.2M	27.0%	0.0%	0.0%	8.2M	0.0bp
cpc4_mature_hairpin_genome													2.38%	0.0M	35.8M	98.6%	0.0%	0.0%	36.3M	0.0bp
cpc5	93.9%	96.7%	377.2Mb	14.9M	48.0%	96.5%	0.0%	76.0bp	4.4M	0.0%	0.0M	4.4M															97.1%	47.0%	26bp	22bp	45%	14.9M
cpc5.raw																					95.9%	51.0%	76bp	76bp	55%	15.4M
cpc5_mature													0.43%	0.0M	8.0M	52.7%	0.0%	0.0%	15.2M	0.0bp
cpc5_mature_hairpin													3.67%	0.0M	1.9M	24.8%	0.0%	0.0%	7.7M	0.0bp
cpc5_mature_hairpin_genome													2.28%	0.0M	43.1M	98.8%	0.0%	0.0%	43.6M	0.0bp
cpc6	94.0%	96.4%	441.8Mb	15.6M	51.0%	93.4%	0.5%	76.0bp	2.1M	0.0%	0.0M	2.1M															97.5%	50.0%	29bp	32bp	36%	15.6M
cpc6.raw																					95.6%	51.0%	76bp	76bp	45%	16.7M
cpc6_mature													0.40%	0.0M	3.8M	24.1%	0.0%	0.0%	15.8M	0.0bp
cpc6_mature_hairpin													3.15%	0.0M	1.0M	8.5%	0.0%	0.0%	12.2M	0.0bp
cpc6_mature_hairpin_genome													2.15%	0.0M	85.1M	98.7%	0.0%	0.0%	86.2M	0.0bp
cpc7	93.2%	96.6%	403.4Mb	15.0M	49.9%	95.4%	0.0%	76.0bp	3.2M	0.0%	0.0M	3.2M															96.9%	49.0%	28bp	24bp	45%	15.0M
cpc7.raw																					95.6%	51.0%	76bp	76bp	55%	15.8M
cpc7_mature													0.45%	0.0M	5.7M	37.6%	0.0%	0.0%	15.3M	0.0bp
cpc7_mature_hairpin													3.14%	0.0M	1.6M	16.5%	0.0%	0.0%	9.9M	0.0bp
cpc7_mature_hairpin_genome													2.40%	0.0M	54.9M	98.8%	0.0%	0.0%	55.6M	0.0bp
pc1	91.6%	97.6%	339.5Mb	12.0M	50.2%	96.3%	0.0%	76.0bp	2.0M	0.0%	0.0M	2.0M															94.6%	50.0%	29bp	32bp	45%	12.0M
pc1.raw																					93.2%	51.0%	76bp	76bp	55%	12.5M
pc1_mature													0.40%	0.0M	3.3M	26.9%	0.0%	0.0%	12.1M	0.0bp
pc1_mature_hairpin													3.12%	0.0M	0.8M	8.8%	0.0%	0.0%	9.1M	0.0bp
pc1_mature_hairpin_genome													2.06%	0.0M	70.2M	98.9%	0.0%	0.0%	71.0M	0.0bp
pc2	93.2%	97.7%	368.1Mb	13.4M	49.5%	95.8%	3.8%	76.0bp	2.6M	0.0%	0.0M	2.6M															96.5%	49.0%	28bp	30bp	36%	13.4M
pc2.raw																					94.8%	51.0%	76bp	76bp	55%	14.0M
pc2_mature													0.40%	0.0M	4.6M	33.6%	0.0%	0.0%	13.6M	0.0bp
pc2_mature_hairpin													3.64%	0.0M	1.2M	13.3%	0.0%	0.0%	9.3M	0.0bp
pc2_mature_hairpin_genome													2.02%	0.0M	74.9M	98.9%	0.0%	0.0%	75.7M	0.0bp
pc3	95.1%	97.1%	424.5Mb	16.7M	47.8%	96.1%	0.0%	76.0bp	4.6M	0.0%	0.0M	4.6M															97.7%	47.0%	26bp	22bp	55%	16.7M
pc3.raw																					96.6%	50.0%	76bp	76bp	64%	17.3M
pc3_mature													0.45%	0.0M	8.5M	50.4%	0.0%	0.0%	16.9M	0.0bp
pc3_mature_hairpin													3.54%	0.0M	2.2M	24.3%	0.0%	0.0%	9.0M	0.0bp
pc3_mature_hairpin_genome													2.06%	0.0M	57.5M	99.1%	0.0%	0.0%	58.0M	0.0bp
pc4	93.8%	96.9%	348.3Mb	13.4M	47.9%	94.5%	3.7%	76.0bp	3.6M	0.0%	0.0M	3.6M															96.9%	47.0%	27bp	22bp	45%	13.4M
pc4.raw																					95.5%	51.0%	76bp	76bp	64%	14.2M
pc4_mature													0.39%	0.0M	5.8M	42.7%	0.0%	0.0%	13.6M	0.0bp
pc4_mature_hairpin													2.98%	0.0M	2.0M	24.2%	0.0%	0.0%	8.2M	0.0bp
pc4_mature_hairpin_genome													2.16%	0.0M	49.7M	99.0%	0.0%	0.0%	50.2M	0.0bp
pc5	93.9%	97.3%	287.2Mb	10.2M	51.0%	95.7%	0.0%	76.0bp	1.6M	0.0%	0.0M	1.6M															97.3%	50.0%	29bp	32bp	45%	10.2M
pc5.raw																					95.9%	52.0%	76bp	76bp	55%	10.7M
pc5_mature													0.40%	0.0M	2.7M	26.4%	0.0%	0.0%	10.3M	0.0bp
pc5_mature_hairpin													3.09%	0.0M	0.9M	10.9%	0.0%	0.0%	7.8M	0.0bp
pc5_mature_hairpin_genome													2.17%	0.0M	51.9M	98.9%	0.0%	0.0%	52.5M	0.0bp
pc6	94.0%	97.2%	474.3Mb	17.0M	49.8%	95.6%	0.6%	76.0bp	2.9M	0.0%	0.0M	2.9M															97.0%	49.0%	29bp	32bp	45%	17.0M
pc6.raw																					95.5%	51.0%	76bp	76bp	55%	17.7M
pc6_mature													0.36%	0.0M	4.7M	27.8%	0.0%	0.0%	17.1M	0.0bp
pc6_mature_hairpin													2.91%	0.0M	1.3M	10.3%	0.0%	0.0%	12.6M	0.0bp
pc6_mature_hairpin_genome													2.05%	0.0M	97.6M	99.1%	0.0%	0.0%	98.5M	0.0bp
pc7	93.2%	96.5%	381.7Mb	14.9M	48.0%	93.6%	0.5%	76.0bp	4.2M	0.0%	0.0M	4.2M															96.8%	48.0%	27bp	22bp	45%	14.9M
pc7.raw																					95.2%	51.0%	76bp	76bp	45%	15.9M
pc7_mature													0.43%	0.0M	6.8M	45.2%	0.0%	0.0%	15.1M	0.0bp
pc7_mature_hairpin													3.04%	0.0M	2.1M	23.9%	0.0%	0.0%	8.8M	0.0bp
pc7_mature_hairpin_genome													2.32%	0.0M	51.4M	98.8%	0.0%	0.0%	52.0M	0.0bp

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table_table

Sort	Group	Column	Description	ID	Scale
\|\|	fastp	% Duplication	Duplication rate before filtering	`fastp-pct_duplication`
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`fastp-after_filtering_q30_rate`
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`fastp-after_filtering_q30_bases`	base_count
\|\|	fastp	Reads After Filtering	Total reads after filtering (millions)	`fastp-filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`fastp-after_filtering_gc_content`
\|\|	fastp	% PF	Percent reads passing filter	`fastp-pct_surviving`
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`fastp-pct_adapter`
\|\|	fastp	Mean R1 Length	Mean read length of R1	`fastp-before_filtering_read1_mean_length`
\|\|	mirtop	M Ref miRNA reads	Read counts summed over all reference miRNAs (millions)	`mirtop-ref_miRNA_sum`	read_count
\|\|	mirtop	IsomiR %	% of total read counts corresponding to isomiRs	`mirtop-isomiR_perc`
\|\|	mirtop	M IsomiR reads	Read counts summed over all isomiRs (millions)	`mirtop-isomiR_sum`	read_count
\|\|	mirtop	M Reads	Total read counts - both isomiRs and reference miRNA (millions)	`mirtop-read_count`	read_count
\|\|	Samtools: stats	Error rate	Error rate: mismatches (NM) / bases mapped (CIGAR)	`samtools_stats-error_rate`
\|\|	Samtools: stats	Non-primary	Non-primary alignments (millions)	`samtools_stats-non_primary_alignments`	read_count
\|\|	Samtools: stats	Reads mapped	Reads mapped in the bam file (millions)	`samtools_stats-reads_mapped`	read_count
\|\|	Samtools: stats	% Mapped	% Mapped reads	`samtools_stats-reads_mapped_percent`
\|\|	Samtools: stats	% Proper pairs	% Properly paired reads	`samtools_stats-reads_properly_paired_percent`
\|\|	Samtools: stats	% MapQ 0 reads	% of reads that are ambiguously placed (MapQ=0)	`samtools_stats-reads_MQ0_percent`
\|\|	Samtools: stats	Total seqs	Total sequences in the bam file (millions)	`samtools_stats-raw_total_sequences`	read_count
\|\|	Samtools: stats	Mean insert	Average insert size	`samtools_stats-insert_size_average`
\|\|	FastQC (raw)	Dups	% duplicate reads	`fastqc_raw-percent_duplicates`
\|\|	FastQC (raw)	GC	Average % GC content	`fastqc_raw-percent_gc`
\|\|	FastQC (raw)	Avg len	Average read length	`fastqc_raw-avg_sequence_length`
\|\|	FastQC (raw)	Median len	Median read length	`fastqc_raw-median_sequence_length`
\|\|	FastQC (raw)	Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`fastqc_raw-percent_fails`
\|\|	FastQC (raw)	Seqs	Total sequences (millions)	`fastqc_raw-total_sequences`	read_count
\|\|	FastQC (trimmed)	Dups	% duplicate reads	`fastqc_trimmed-percent_duplicates`
\|\|	FastQC (trimmed)	GC	Average % GC content	`fastqc_trimmed-percent_gc`
\|\|	FastQC (trimmed)	Avg len	Average read length	`fastqc_trimmed-avg_sequence_length`
\|\|	FastQC (trimmed)	Median len	Median read length	`fastqc_trimmed-median_sequence_length`
\|\|	FastQC (trimmed)	Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`fastqc_trimmed-percent_fails`
\|\|	FastQC (trimmed)	Seqs	Total sequences (millions)	`fastqc_trimmed-total_sequences`	read_count

fastp

All-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).https://github.com/OpenGene/fastpDOI: 10.1093/bioinformatics/bty560

Fastp goes through fastq files in a folder and perform a series of quality control and filtering. Quality control and reporting are displayed both before and after filtering, allowing for a clear depiction of the consequences of the filtering process. Notably, the latter can be conducted on a variety of parameters including quality scores, length, as well as the presence of adapters, polyG, or polyX tailing.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

mirtop

Annotates miRNAs and isomiRs and compute general statistics in mirGFF3 format.https://github.com/miRTop/mirtopDOI: 10.5281/zenodo.45385

This tool is dedicated to the creation and management of miRNA alignment output using the standardized GFF3 format (see [miRTop/mirGFF3](https://github.com/miRTop/mirGFF3)). A unified miRNA alignment format allows to easily compare the output of different alignment tools. Currently, mirtop can convert into mirGFF3 the outputs of commonly used pipelines, such as seqbuster, isomiR-SEA, sRNAbench, Prost! as well as BAM files.

IsomiR read counts

Total counts of reads aligned for each isomiR type, over all detected miRNAs.

The total counts of reads detected as reference miRNA sequences is also shown.

Since a read can belong to 2 (or more) different isomiRs types (e.g iso_3p and iso_5p), the cumulative read counts shown in this plot for a sample can be higher than its total read count shown in the general statistics.

For each sample, the mean counts of each type of isomiRs over all detected miRNAs is displayed in a different color.

The different isomiR types are:

iso_3p: a sequence with a 3' end difference because of trimming or templated tailing
iso_5p: a sequence with a 5' end difference because of trimming or templated tailing
iso_add3p: a sequence with non templated tailing in the 3' end
iso_add5p: a sequence with non templated tailing in the 5' end
iso_snv: a sequence with a single nucleotide variant

The ref_miRNA label corresponds to the reference miRNA (canonical sequence).

Created with MultiQC

IsomiR unique read counts

The number of distinct sequences detected for each isomiR type, over all miRNAs.

The number of reference miRNA sequences detected is also shown.

For each sample, the number of miRNAs with each type of isomiRs, is displayed in a different color.

The different isomiR types are:

iso_3p: a sequence with a 3' end difference because of trimming or templated tailing
iso_5p: a sequence with a 5' end difference because of trimming or templated tailing
iso_add3p: a sequence with non templated tailing in the 3' end
iso_add5p: a sequence with non templated tailing in the 5' end
iso_snv: a sequence with a single nucleotide variant

The ref_miRNA label corresponds to the reference miRNA (canonical sequence).

Created with MultiQC

Mean isomiR read counts

Mean counts for each isomiR type, over all detected miRNAs.

The mean counts of reads detected as reference miRNA sequences is also shown.

For each sample, the mean counts of each type of isomiRs over all detected miRNAs is displayed in a different color.

The different isomiR types are:

iso_3p: a sequence with a 3' end difference because of trimming or templated tailing
iso_5p: a sequence with a 5' end difference because of trimming or templated tailing
iso_add3p: a sequence with non templated tailing in the 3' end
iso_add5p: a sequence with non templated tailing in the 5' end
iso_snv: a sequence with a single nucleotide variant

The ref_miRNA label corresponds to the reference miRNA (canonical sequence).

Created with MultiQC

miRTrace

Quality control for small RNA sequencing data.https://github.com/friedlanderlab/mirtraceDOI: 10.1186/s13059-018-1588-9

miRTrace performs adapter trimming and discards the reads that fail to pass the QC filters. miRTrace specifically addresses sequencing quality, read length, sequencing depth and miRNA complexity and also identifies the presence of both miRNAs and undesirable sequences derived from tRNAs, rRNAs, or Illumina artifact sequences. miRTrace also profiles clade-specific miRNAs based on a comprehensive catalog of clade-specific miRNA families identified previously. With this information, miRTrace can detect exogenous miRNAs, which could be contamination derived, e.g. index mis-assignment on sample demultiplexing, or biologically derived, e.g. parasitic RNAs.

QC Plot

Created with MultiQC

RNA Categories

Created with MultiQC

Read Length Distribution

Created with MultiQC

Contamination Check

Created with MultiQC

miRNA Complexity

Created with MultiQC

Samtools

Toolkit for interacting with BAM/CRAM files.http://www.htslib.orgDOI: 10.1093/bioinformatics/btp352

Percent mapped

Alignment metrics from samtools stats; mapped vs. unmapped reads vs. reads mapped with MQ0.

For a set of samples that have come from the same multiplexed library, similar numbers of reads for each sample are expected. Large differences in numbers might indicate issues during the library preparation process. Whilst large differences in read numbers may be controlled for in downstream processings (e.g. read count normalisation), you may wish to consider whether the read depths achieved have fallen below recommended levels depending on the applications.

Low alignment rates could indicate contamination of samples (e.g. adapter sequences), low sequencing quality or other artefacts. These can be further investigated in the sequence level QC (e.g. from FastQC).

Reads mapped with MQ0 often indicate that the reads are ambiguously mapped to multiple locations in the reference sequence. This can be due to repetitive regions in the genome, the presence of alternative contigs in the reference, or due to reads that are too short to be uniquely mapped. These reads are often filtered out in downstream analyses.

Created with MultiQC

Alignment stats

This module parses the output from samtools stats. All numbers in millions.

Created with MultiQC

Showing ⁸⁴/₈₄ rows and ¹³/₁₃ columns.

Sample Name	Total sequences	Mapped & paired	Properly paired	Duplicated	QC Failed	Reads MQ0	Mapped bases (CIGAR)	Bases Trimmed	Duplicated bases	Diff chromosomes	Other orientation	Inward pairs	Outward pairs
c1_mature	11.1M	0.0M	0.0M	0.0M	0.0M	0.0M	48.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c1_mature_hairpin	8.9M	0.0M	0.0M	0.0M	0.0M	0.0M	12.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c1_mature_hairpin_genome	95.9M	0.0M	0.0M	0.0M	0.0M	0.0M	3348.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c2_mature	10.8M	0.0M	0.0M	0.0M	0.0M	0.0M	86.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c2_mature_hairpin	7.0M	0.0M	0.0M	0.0M	0.0M	0.0M	28.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c2_mature_hairpin_genome	48.8M	0.0M	0.0M	0.0M	0.0M	0.0M	1637.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c3_mature	9.6M	0.0M	0.0M	0.0M	0.0M	0.0M	58.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c3_mature_hairpin	7.1M	0.0M	0.0M	0.0M	0.0M	0.0M	20.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c3_mature_hairpin_genome	37.4M	0.0M	0.0M	0.0M	0.0M	0.0M	1169.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c4_mature	10.8M	0.0M	0.0M	0.0M	0.0M	0.0M	92.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c4_mature_hairpin	6.9M	0.0M	0.0M	0.0M	0.0M	0.0M	23.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c4_mature_hairpin_genome	45.5M	0.0M	0.0M	0.0M	0.0M	0.0M	1510.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c5_mature	11.3M	0.0M	0.0M	0.0M	0.0M	0.0M	98.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c5_mature_hairpin	7.0M	0.0M	0.0M	0.0M	0.0M	0.0M	25.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c5_mature_hairpin_genome	39.7M	0.0M	0.0M	0.0M	0.0M	0.0M	1276.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c6_mature	13.6M	0.0M	0.0M	0.0M	0.0M	0.0M	109.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c6_mature_hairpin	8.9M	0.0M	0.0M	0.0M	0.0M	0.0M	26.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c6_mature_hairpin_genome	61.9M	0.0M	0.0M	0.0M	0.0M	0.0M	2069.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c7_mature	14.2M	0.0M	0.0M	0.0M	0.0M	0.0M	92.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c7_mature_hairpin	10.2M	0.0M	0.0M	0.0M	0.0M	0.0M	24.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
c7_mature_hairpin_genome	80.5M	0.0M	0.0M	0.0M	0.0M	0.0M	2744.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc1_mature	10.6M	0.0M	0.0M	0.0M	0.0M	0.0M	117.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc1_mature_hairpin	5.6M	0.0M	0.0M	0.0M	0.0M	0.0M	40.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc1_mature_hairpin_genome	18.0M	0.0M	0.0M	0.0M	0.0M	0.0M	542.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc2_mature	12.3M	0.0M	0.0M	0.0M	0.0M	0.0M	120.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc2_mature_hairpin	7.0M	0.0M	0.0M	0.0M	0.0M	0.0M	23.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc2_mature_hairpin_genome	52.6M	0.0M	0.0M	0.0M	0.0M	0.0M	1772.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc3_mature	10.3M	0.0M	0.0M	0.0M	0.0M	0.0M	77.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc3_mature_hairpin	7.0M	0.0M	0.0M	0.0M	0.0M	0.0M	26.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc3_mature_hairpin_genome	44.8M	0.0M	0.0M	0.0M	0.0M	0.0M	1502.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc4_mature	11.2M	0.0M	0.0M	0.0M	0.0M	0.0M	118.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc4_mature_hairpin	6.1M	0.0M	0.0M	0.0M	0.0M	0.0M	33.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc4_mature_hairpin_genome	27.2M	0.0M	0.0M	0.0M	0.0M	0.0M	845.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc5_mature	10.4M	0.0M	0.0M	0.0M	0.0M	0.0M	120.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc5_mature_hairpin	5.2M	0.0M	0.0M	0.0M	0.0M	0.0M	26.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc5_mature_hairpin_genome	31.3M	0.0M	0.0M	0.0M	0.0M	0.0M	1018.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc6_mature	12.8M	0.0M	0.0M	0.0M	0.0M	0.0M	72.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc6_mature_hairpin	9.6M	0.0M	0.0M	0.0M	0.0M	0.0M	19.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc6_mature_hairpin_genome	69.5M	0.0M	0.0M	0.0M	0.0M	0.0M	2350.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc7_mature	14.7M	0.0M	0.0M	0.0M	0.0M	0.0M	122.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc7_mature_hairpin	9.4M	0.0M	0.0M	0.0M	0.0M	0.0M	31.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cc7_mature_hairpin_genome	53.3M	0.0M	0.0M	0.0M	0.0M	0.0M	1726.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc1_mature	15.8M	0.0M	0.0M	0.0M	0.0M	0.0M	176.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc1_mature_hairpin	8.3M	0.0M	0.0M	0.0M	0.0M	0.0M	62.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc1_mature_hairpin_genome	27.9M	0.0M	0.0M	0.0M	0.0M	0.0M	848.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc2_mature	14.8M	0.0M	0.0M	0.0M	0.0M	0.0M	135.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc2_mature_hairpin	9.0M	0.0M	0.0M	0.0M	0.0M	0.0M	31.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc2_mature_hairpin_genome	66.4M	0.0M	0.0M	0.0M	0.0M	0.0M	2102.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc3_mature	15.0M	0.0M	0.0M	0.0M	0.0M	0.0M	131.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc3_mature_hairpin	9.4M	0.0M	0.0M	0.0M	0.0M	0.0M	46.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc3_mature_hairpin_genome	61.8M	0.0M	0.0M	0.0M	0.0M	0.0M	1923.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc4_mature	15.3M	0.0M	0.0M	0.0M	0.0M	0.0M	164.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc4_mature_hairpin	8.2M	0.0M	0.0M	0.0M	0.0M	0.0M	51.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc4_mature_hairpin_genome	36.3M	0.0M	0.0M	0.0M	0.0M	0.0M	1101.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc5_mature	15.2M	0.0M	0.0M	0.0M	0.0M	0.0M	173.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc5_mature_hairpin	7.7M	0.0M	0.0M	0.0M	0.0M	0.0M	44.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc5_mature_hairpin_genome	43.6M	0.0M	0.0M	0.0M	0.0M	0.0M	1374.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc6_mature	15.8M	0.0M	0.0M	0.0M	0.0M	0.0M	82.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc6_mature_hairpin	12.2M	0.0M	0.0M	0.0M	0.0M	0.0M	23.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc6_mature_hairpin_genome	86.2M	0.0M	0.0M	0.0M	0.0M	0.0M	2724.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc7_mature	15.3M	0.0M	0.0M	0.0M	0.0M	0.0M	124.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc7_mature_hairpin	9.9M	0.0M	0.0M	0.0M	0.0M	0.0M	37.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
cpc7_mature_hairpin_genome	55.6M	0.0M	0.0M	0.0M	0.0M	0.0M	1747.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc1_mature	12.1M	0.0M	0.0M	0.0M	0.0M	0.0M	70.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc1_mature_hairpin	9.1M	0.0M	0.0M	0.0M	0.0M	0.0M	18.3Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc1_mature_hairpin_genome	71.0M	0.0M	0.0M	0.0M	0.0M	0.0M	2251.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc2_mature	13.6M	0.0M	0.0M	0.0M	0.0M	0.0M	99.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc2_mature_hairpin	9.3M	0.0M	0.0M	0.0M	0.0M	0.0M	28.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc2_mature_hairpin_genome	75.7M	0.0M	0.0M	0.0M	0.0M	0.0M	2390.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc3_mature	16.9M	0.0M	0.0M	0.0M	0.0M	0.0M	185.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc3_mature_hairpin	9.0M	0.0M	0.0M	0.0M	0.0M	0.0M	50.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc3_mature_hairpin_genome	58.0M	0.0M	0.0M	0.0M	0.0M	0.0M	1835.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc4_mature	13.6M	0.0M	0.0M	0.0M	0.0M	0.0M	125.8Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc4_mature_hairpin	8.2M	0.0M	0.0M	0.0M	0.0M	0.0M	46.1Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc4_mature_hairpin_genome	50.2M	0.0M	0.0M	0.0M	0.0M	0.0M	1594.4Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc5_mature	10.3M	0.0M	0.0M	0.0M	0.0M	0.0M	58.9Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc5_mature_hairpin	7.8M	0.0M	0.0M	0.0M	0.0M	0.0M	19.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc5_mature_hairpin_genome	52.5M	0.0M	0.0M	0.0M	0.0M	0.0M	1657.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc6_mature	17.1M	0.0M	0.0M	0.0M	0.0M	0.0M	103.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc6_mature_hairpin	12.6M	0.0M	0.0M	0.0M	0.0M	0.0M	30.0Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc6_mature_hairpin_genome	98.5M	0.0M	0.0M	0.0M	0.0M	0.0M	3117.6Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc7_mature	15.1M	0.0M	0.0M	0.0M	0.0M	0.0M	148.7Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc7_mature_hairpin	8.8M	0.0M	0.0M	0.0M	0.0M	0.0M	48.5Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M
pc7_mature_hairpin_genome	52.0M	0.0M	0.0M	0.0M	0.0M	0.0M	1641.2Mb	0.0Mb	0.0Mb	0.0M	0.0M	0.0M	0.0M

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: samtools-stats-dp_table

Sort	Column	Description	ID	Scale
\|\|	Total sequences	Total sequences	`raw_total_sequences`	read_count
\|\|	Mapped & paired	Paired-end technology bit set + both mates mapped	`reads_mapped_and_paired`	read_count
\|\|	Properly paired	Proper-pair bit set	`reads_properly_paired`	read_count
\|\|	Duplicated	PCR or optical duplicate bit set	`reads_duplicated`	read_count
\|\|	QC Failed	QC Failed	`reads_QC_failed`	read_count
\|\|	Reads MQ0	Reads mapped and MQ=0	`reads_MQ0`	read_count
\|\|	Mapped bases (CIGAR)	Mapped bases (CIGAR)	`bases_mapped__cigar`	base_count
\|\|	Bases Trimmed	Bases Trimmed	`bases_trimmed`	base_count
\|\|	Duplicated bases	Duplicated bases	`bases_duplicated`	base_count
\|\|	Diff chromosomes	Pairs on different chromosomes	`pairs_on_different_chromosomes`	read_count
\|\|	Other orientation	Pairs with other orientation	`pairs_with_other_orientation`	read_count
\|\|	Inward pairs	Inward oriented pairs	`inward_oriented_pairs`	read_count
\|\|	Outward pairs	Outward oriented pairs	`outward_oriented_pairs`	read_count

FastQC (raw)

This section of the report shows FastQC results on the input files.http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

14

3

11

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

28

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

$ Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

13

15

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

28

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

28

All samples have sequences of a single length (36bp, 76bp) See the General Statistics Table.

Sequence Duplication Levels

28

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (e.g. PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Reports	Occurrences	% of all reads
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGG	14	6615357	1.5759%
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGG	14	5722433	1.3632%
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGT	14	5566450	1.3260%
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGA	14	5226285	1.2450%
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGT	14	4536521	1.0807%
AAGCTGCCAGTTGAAGAACTGTTGGAATTCTCGGGT	14	3018607	0.7191%
GGCTGGTCCGATGGTAGTGGGTTATCAGAACTTGGA	14	2884136	0.6870%
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGC	14	2766229	0.6590%
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTG	14	2286475	0.5447%
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGT	14	2003101	0.4772%
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCATGG	14	1862855	0.4438%
TGAGGTAGTAGATTGTATAGTTTGGAATTCTCGGGT	14	1388237	0.3307%
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTG	14	1243385	0.2962%
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGG	14	1202761	0.2865%
TCGGATCCGTCTGAGCTTGGCTTGGAATTCTCGGGT	14	1176509	0.2803%
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGC	14	843823	0.2010%
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGT	14	569788	0.1357%
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTG	14	540128	0.1287%
CAACGGAATCCCAAAAGCAGCTGTGGAATTCTCGGG	14	527603	0.1257%
TGAGGTAGTAGATTGTATAGTTGGAATTCTCGGGTG	14	386574	0.0921%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table_table

Sort	Column	Description	ID
\|\|	Reports	Number of FastQC reports where this sequence is founds as overrepresented	`fastqc_raw-samples`
\|\|	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`fastqc_raw-total_count`
\|\|	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`fastqc_raw-total_percent`

Adapter Content

28

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Created with MultiQC

FastQC (trimmed)

This section of the report shows FastQC results after adapter trimming.http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

17

4

7

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

28

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

$ Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

15

13

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

28

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

28

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

28

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Reports	Occurrences	% of all reads
AACATTCAACGCTGTCGGTGAGT	28	14005616	3.8425%
TTCAAGTAATCCAGGATAGGCT	28	13364824	3.6667%
AACATTCAACGCTGTCGGTGAG	28	11776183	3.2309%
TTCACAGTGGCTAAGTTCTG	28	6189784	1.6982%
TGAGGTAGTAGGTTGTATAGTT	28	5697039	1.5630%
TGAGGTAGTAGATTGTATAGTT	28	3804835	1.0439%
TCTTTGGTTATCTAGCTGTATGA	28	3108229	0.8528%
TCGGATCCGTCTGAGCTTGGCT	28	2671918	0.7331%
AACATTCAACGCTGTCGGTGA	28	2609353	0.7159%
TGAGATGAAGCACTGTAGCT	28	2205759	0.6052%
TGAGGTAGTAGGTTGTATAGT	28	1400302	0.3842%
TGAGATGAAGCACTGTAGCTC	28	1394316	0.3825%
TGAGGTAGTAGTTTGTACAGTT	28	1385468	0.3801%
CAACGGAATCCCAAAAGCAGCTG	28	1331046	0.3652%
TATTGCACTCGTCCCGGCCTCC	28	1315079	0.3608%
TGAGGTAGTAGGTTGTATGGTT	28	1265059	0.3471%
TCTTTGGTTATCTAGCTGTAT	28	1066898	0.2927%
TGAGGTAGTAGATTGTATAGT	28	993960	0.2727%
TCGAGGAGCTCACAGTCTAGT	28	906889	0.2488%
TGAGGTAGTAGTTTGTGCTGTT	28	672463	0.1845%

Expand table

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc-1_top_overrepresented_sequences_table_table

Sort	Column	Description	ID
\|\|	Reports	Number of FastQC reports where this sequence is founds as overrepresented	`fastqc_trimmed-samples`
\|\|	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`fastqc_trimmed-total_count`
\|\|	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`fastqc_trimmed-total_percent`

Adapter Content

28

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
BOWTIE_MAP_GENOME	bowtie	`1.3.1`
	samtools	`1.21`
BOWTIE_MAP_HAIRPIN	bowtie	`1.3.1`
	samtools	`1.21`
BOWTIE_MAP_MATURE	bowtie	`1.3.1`
	samtools	`1.21`
BOWTIE_MAP_SEQCLUSTER	bowtie	`1.3.1`
	samtools	`1.21`
DATATABLE_MERGE	r-base	`3.6.2`
FASTQC_RAW	fastqc	`0.12.1`
FASTQC_TRIM	fastqc	`0.12.1`
FORMAT_HAIRPIN	fastx_toolkit	`0.0.14`
FORMAT_MATURE	fastx_toolkit	`0.0.14`
INDEX_HAIRPIN	bowtie	`1.3.1`
INDEX_MATURE	bowtie	`1.3.1`
MIRDEEP2_MAPPER	mirdeep2	`2.0.1`
MIRDEEP2_MIRDEEP2	mirdeep2	`2.0.1`
MIRTOP_COUNTS	mirtop	`0.4.30`
MIRTOP_EXPORT	mirtop	`0.4.30`
MIRTOP_GFF	mirtop	`0.4.30`
MIRTOP_STATS	mirtop	`0.4.30`
MIRTRACE_QC	mirtrace	`1.0.1`
PARSE_HAIRPIN	seqkit	`2.6.1`
PARSE_MATURE	seqkit	`2.6.1`
PIVOT_LONGER	optparse	`1.7.5`
	r-base	`4.4.2`
	tidyr	`1.3.1`
PIVOT_WIDER	dplyr	`1.1.4`
	optparse	`1.7.5`
	r-base	`4.4.2`
	tidyr	`1.3.1`
	vroom	`1.6.5`
SAMTOOLS_FLAGSTAT	samtools	`1.22.1`
SAMTOOLS_IDXSTATS	samtools	`1.22.1`
SAMTOOLS_INDEX	samtools	`1.22.1`
SAMTOOLS_SORT	samtools	`1.22.1`
SAMTOOLS_STATS	samtools	`1.22.1`
SEQCLUSTER_COLLAPSE	seqcluster	`1.2.9`
SEQKIT_FQ2FA	seqkit	`2.9.0`
SEQKIT_REPLACE	seqkit	`2.9.0`
Workflow	Nextflow	`25.10.2`
	nf-core/smrnaseq	`v2.4.1-gcb0af57`
fastp	fastp	`1.0.1`

nf-core/smrnaseq Workflow Summary

this information is collected when the pipeline is started.https://github.com/nf-core/smrnaseq

Input/output options

input: https://github.com/nf-core/test-datasets/raw/smrnaseq/samplesheet/v2.0/samplesheet-full.csv
outdir: s3://nf-core-awsmegatests/smrnaseq/results-cb0af579b24cb8d5a3accd87b2f14ea93fe04832

Reference genome options

fasta: s3://ngi-igenomes/igenomes//Homo_sapiens/Ensembl/GRCh37/Sequence/WholeGenomeFasta/genome.fa
genome: GRCh37
mirtrace_species: hsa

Institutional config options

config_profile_description: Full test dataset to check pipeline function
config_profile_name: Full test profile

Generic options

hook_url: https://hooks.slack.com/services/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
trace_report_suffix: 2026-01-07_13-43-10

Core Nextflow options

configFiles: /.nextflow/assets/nf-core/smrnaseq/nextflow.config, /nextflow.config
launchDir: /
profile: test_full
projectDir: /.nextflow/assets/nf-core/smrnaseq
revision: 2.4.1
runName: pedantic_einstein
userName: root
workDir: /nf-core-awsmegatests/work/smrnaseq/work-cb0af579b24cb8d5a3accd87b2f14ea93fe04832

MultiQC Toolbox

Apply Highlight Samples

Rename Samples Bulk input Apply

Apply Show / Hide Samples

Explain with AI

Export Plots

Choose Plots All None

Save Settings

Load Settings

Tool Citations

About MultiQC

Report AI Summary

General Statistics

AI Summary

General Statistics: Columns

fastp

Filtered Reads

AI Summary

Sequence Quality

AI Summary

GC Content

AI Summary

N content

AI Summary

mirtop

IsomiR read counts Help

AI Summary

IsomiR unique read counts Help

AI Summary

Mean isomiR read counts Help

AI Summary

miRTrace

QC Plot

AI Summary

RNA Categories

AI Summary

Read Length Distribution

AI Summary

Contamination Check

AI Summary

miRNA Complexity

AI Summary

Samtools

Percent mapped Help

AI Summary

Alignment stats

AI Summary

Samtools: stats: Alignment Stats: Columns

FastQC (raw)

Sequence Counts Help

AI Summary

AI Summary

AI Summary

Per Base Sequence Content Help

AI Summary

Rollover for sample name

AI Summary

AI Summary

AI Summary

AI Summary

Overrepresented sequences by sample Help

AI Summary

Top overrepresented sequences

AI Summary

FastQC: Top overrepresented sequences: Columns

AI Summary

Status Checks Help

AI Summary

FastQC (trimmed)

Sequence Counts Help

AI Summary

AI Summary

AI Summary

Per Base Sequence Content Help

AI Summary

Rollover for sample name

AI Summary

AI Summary

AI Summary

AI Summary

Highlight Samples

Rename Samples

Show / Hide Samples

Choose Plots

IsomiR read counts

IsomiR unique read counts

Mean isomiR read counts

Percent mapped

Sequence Counts

Per Base Sequence Content

Overrepresented sequences by sample

Status Checks

Sequence Counts

Per Base Sequence Content

Overrepresented sequences by sample

Status Checks